Volume 23
(6):594-605, 2019.
Prevalence and phylogeny of Cysticercus
Tenuicollis spp determined by PCR from 6909 slaughtered sheep over 12
months.
Athmar K
Abbas Al-Azawi, Suha Tarik Al-Biatee.
Department of
Parasitology, College of Veterinary Medicine, University of Baghdad, Iraq.
ABSTRACT
Al-Azawi AWA, Al-Biatee ST., Prevalence and phylogeny of Cysticercus
Tenuicollis spp determined by PCR from 6909 slaughtered sheep over 12 months, Onl
J Vet Res., 23 (6):594-605, 2019. We report prevalence and type of Cysticercus (C) tenuicollis excised from sheep metacestodes of adult Taenia. hydatigena at meat
inspections over a 1 year period at a Baghdad, Iraq, abbatoir. C. tenuicollis cysts
were subjected to
Keywords: Cysticercus tenuicollis,
sheep, risk factor, PCR, phylogeny.
INTRODUCTION
Cysticercus
tenuicollis is the metacestode of adult Taenia
hydatigena
tapeworm life cycle maintained in domestic and wild animals infected by larvae (Taylor et al., 2007). Dogs discharge eggs in feces and when ingested,
onchospheres hatch in the small intestine and reach blood via the liver and
peritoneum where they develop to C. tenuicollis
with translucent clear jelly like fluid
and one invagination scolex bearing rostellar hooks, which attach to
serous surface of liver, spleen, lung, great omentum, intestinal mesentery,
kidney, heart and peritoneal cavity ( Radostits et.al., 2007), However,
aberrant location and unusual locations of C. tenuicollis vesicle have
been described (Payan-Carreira et.al, 2008). Migration
of cysticercii through liver produces hemorrhage, fibrosis, eosinophilia and
peritonitis often a fatalco-infection with Clostridia (Oryan et al., 2012: Darzi, 2002). Infestations
cause high morbidity and mortality in livestock and condemnation at
abbatoirs (Wondimu et al., 2011: Endale et al., 2013 and Nimbalkar et al., 2011). Genetic
characterization of T. hydatigena isolates has been determined
(Radfar et al., 2005: Mosaab et al., 2016 and Alaa Azmy, 2014 ) but in Iraq remain unknown. We report prevalence and
phylogeny of Cysticercus Tenuicollis spp
in Iraq determined by PCR from 6909 slaughtered sheep.
MATERIALS AND METHODS
At Alshulla
abbatoir, Iraq, 6909 sheep carcasses were inspected from August 2017 to 30 July
2018 for C. tenuiocollis. There were 4910 male and 1999 females
grouped into 2678 3-7 month old, 3845 8-11 month and 386
>12 month sheep. Eleven well defined C tenuicollis
cysts were excised into ice for typing at the Department of Parasitology,
College of Veterinary Medicine, Baghdad University,
Iraq. Cysts were cut into small pieces placed in
phosphate-buffered saline (PBS) and Genomic DNA was extracted from 20μg of
each cyst sample with DNeasy TM Kit (Qiagen company,Germany) following the
manufacturer’s procedure (Qiagen, China). DNA was confirmed by Nano drop
spectrophotometer (THERMO, USA) for Purity and concentration at an absorbance of
260/280 nm . Mitochondrial DNA coding for
cytochrome c oxidase subunit 1 (COx1) genes was amplified with primers JB3 and
JB4. (Promega, USA) as described by Utuk and Piskin (2012) in Table 1 yielding a fragment of ~446bp.
Table 1: Primer Sequence and PCR product size.
|
PCR product size |
Sequence |
Gene |
|
|
446bp |
(5-TTTTTTGGGCATCCTGAGGTTTAT-3) |
F |
JB3 |
|
.
(5-TAAAGAAAGAACATAATGAAAATG_3) |
R |
JB4 |
|
The reaction mixture consisted
of 2μl of template DNA, 10μl from 2X GoTaq Green Master mix (Promega,
USA, 8.5μl of dNTP mix (10mM), 1μl
of each primer(10 pmol) to volume of 25μl with dH2O. Thermocycling conditions are shown in Table 2.
Table
2: PCR
thermocycler reaction conditions
|
PCR step |
Temp. |
Time |
Repeat |
|
Initial Denaturation |
|
5min |
1 |
|
Denaturation |
|
30sec. |
30 cycle |
|
Annealing |
58C |
30sec |
|
|
Extension |
|
60sec |
|
|
Final extension |
|
5min |
1 |
|
Hold |
|
Forever |
- |
Amplified PCR products were subjected to submarine gel electrophoresis in 1.5% agarose stained with ethidium bromide run simultaneously on a parallel well at 100 volts for 1h. After electrophoresis,
the gel was subjected to UV Transilluminator (UVP, USA) for visualization of nonspecific reaction and band size 100bp
DNA ladder (Promega, USA).
Eleven positive PCR products of C tenuicollis isolates were remitted Bioneer, Korea at 4C for phylogenetic tree
analysis. Data
were analyzed using Statistical Package for the Social Sciences (spss) version
17 for windows software and Microsoft excels 2010. Differences between groups were
analyzed using chi -square test with P < 0.05. (AL-Ukaelii and AL -Shaeb,1998 ).
RESULTS
Results are shown in Figure 1 and Tables 3 to 7 below.
Figure 1: C.
tenuicollis from viscera of sheep.
Table 3. Prevalence
(%) of C. tenuiocollis in slaughtered
sheep
|
P-Value |
Chi-Square |
(%) |
Infected |
Tested |
Sex |
|
0.529 |
15.96 |
13.10 |
646 |
4910 |
Males |
|
16.58 |
337 |
1999 |
Females |
||
|
14.22 |
983 |
6909 |
Total |
Table 4. Incidence
for C. tenuicollis by age (sheep)
|
(%) |
Infection |
Tested |
Months (Age) |
|
6.83 |
183 |
2678 |
3-7 |
|
19.24** |
740 |
3845 |
8-11 |
|
15.54* |
60 |
386 |
>12 |
|
14.22 |
983 |
6909 |
Total |
|
199.86 |
Chi-Square |
||
|
0.004 |
P-Value |
||
Table 5. Presence of C. tenuiocollis in slaughtered
sheep by month.
|
(%) |
Infected |
Tissue |
Month |
|
|
20.98 |
128 |
610 |
August (2017) |
|
|
20.52 |
125 |
609 |
September |
|
|
18.73 |
113 |
603 |
October |
|
|
17.93 |
105 |
606 |
November |
|
|
13.93 |
84 |
603 |
December |
|
|
7.0 |
42 |
600 |
January2018 |
|
|
5.16 |
31B |
600 |
February |
|
|
7.0 |
42B |
600 |
March |
|
|
12.0 |
72B |
600 |
April |
|
|
14.86 |
70A |
471 |
May |
|
|
15.12 |
72A |
476 |
June |
|
|
18.64** |
99A |
531 |
July |
|
|
14.22 |
983 |
6909 |
Total |
|
|
165.29 |
|
Chi-Square |
||
|
0.489 |
|
P-Value |
||
DNA extraction from eleven
tissue isolates yielded
genomic DNA concentrations 40-60ng. The target mt cox1 gene segment of each of 11 DNA samples was amplified detected by PCR with JB3 and JB4 primers to yield a DNA
fragment size of ~446 bp as shown in Figure 2, below.
Figure
2: Amplification of mt-CO1 gene with JB3
and JB4.5 primers. M: Marker bp
The DNA
sequences were edited and aligned with ClustalW (Geneious 9 software) for multiple for multiple sequence alignment .
We found 99% homology for sequences
of C. tenuicollis with reference
sequences under accession number JN827307 (Index Table 1 after the reference
list)
Figure 3.
Nucleotide sequences of partial mt-CO1 for Cysticercus tenuicollis (JN827307) alignment with published (DQ995656,
HQ204206) mt-CO1 sequences of T. hydatigena gene Bank in the NCBI.
Table 6. Polymorphism nucleotide
changes in sense of cytochrome c oxidase subunit I (cox1) gene from sheep.
|
Identities |
Expect |
Score |
Sequence ID |
Nucleotide Range |
Nucleotide |
Location |
Substitution |
Sample |
|
100% |
0.0 |
715 |
ID: AB792722.1 |
49 to 444 |
----------------- |
1 |
||
|
99% |
0.0 |
693 |
ID: JN831306.1 |
757 to 1143 |
A>G |
1006 |
Transition |
2 |
|
100% |
0.0 |
699 |
ID: JQ710616.1 |
1 to 387 |
-------------- |
3 |
||
|
100% |
0.0 |
699 |
ID: JQ710617.1 |
1 to 387 |
--------------- |
4 |
||
|
100% |
0.0 |
713 |
ID: KT372529.1 |
1 to 386 |
-------------- |
5 |
||
|
99% |
0.0 |
726 |
ID: AB792722.1 |
49 to 444 |
A>G |
99 |
Transition |
6 |
|
100% |
0.0 |
732 |
ID: AB792722.1 |
49 to 444 |
--------------- |
7 |
||
|
99% |
7e-94 |
353 |
ID: AB792723.1 |
251 to 444 |
G>C |
91 |
Transversion |
8 |
|
99% |
0.0 |
726 |
ID: AB792722.1 |
49 to 444 |
T>C |
291 |
Transition |
9 |
|
100% |
0.0 |
732 |
ID: AB792722.1 |
49 to 444 |
------------------ |
10 |
||
DISCUSSION
Of 6909 carcasses
we found 983 (~14%) to be
infested (Table 3). Senlik (2008) reported similar findings in Turkey whereas in
Iran Radfar et al, (2005) and Samul and Zewde, (2010) in Ethiopia reported
higher level of infestation. These differences may be attributed to grazing behavior
and management systems (Senlik , 2008) and/or dogs which carry Taenia hydatigena with or
without offal in proximity of livestock as described by Deplazes et al., (1990). To our knowledge, in Iraq,
there is little or no information concerning Taenia hydatigena in
dogs.
There was no difference
in incidence of C tenuicollos between
males and females but we did find differences between age groups. We found only
~7% of 3 to 7 month olds to be infested but older ~15-19%. Wondimu et al., (2011) found that young lambs
may be infested or have developing cysts which cannot be detected. There may be
some degree of immunity which limits infection (Senlik, 2008; Radfar et al.,
2005; Samul and Zewde, 2010). Older sheep allow for development of obvious cysts
as described by Endale Mekuria et al., (2013). Our results show obvious rises in infestation
during Autumm (Table 5) which is probably due to viable eggs remaining in
winter grazing grass eclosing during summer as described by Ghaffar, (2011).
Our partial
sequence of mt-CO1 gene amplified product from 11 C tenuicolis isolates (Figure 2) under GeneBank accession number JN827307
was 99% identical with T. hydatigena
cytochrome oxidase subunit 1 (CO1) gene. Our finding suggests that the cox1 gene sequence
was highly conserved among isolatesand suggest low genetic diversity which may
be due to low prevalence. Rostami et al., (2015) in Iran reported 97%
overall nucleotide variation in CO1 gene with pairwise nucleotide differences 0.3–3.4%.
Phylogenetic analysis did not support genetic variants within the isolates with
Iranian T. hydatigena clustered in
one clade, along with those from China, Turkey and Scandinavia (Rostami et,al.2015).
In Iraq, Athmar (2017) found C.
tenuicollis in hyperendemic regions and maintained that identification of T. hydatigena in livestock
was epidemiology important. In our study delucidation of T. hydatigena mitochondrial DNA may be useful for
eradication of C. tenuicollis in Iraq. Further phylogenetic studies on T. hydatigena using larger samples from different locations
are needed to confirm or findings
REFERENCES
1. Taylor M.,Coop RL and Wall RL . Veterinary
Parasitology 3 rd Edn, Black Well Publishing science Lid lowG, USA.A,
2007; pp. 210-211.
2. Radostits OM,
Gay CC.and. Hinchcliff KW. Veterinary Medicine,
10th Edn, 2007 ;
1582- 1583.
3. Payan-Carreira. R; Silva F, Rodrigies M and Anjos Pires M Cysticercus
tenuicollis vesicle in fetal structures 'report of a case,
Reproduction in Domestic Animals, 2008; 43( 6):764-766.
4. Oryan A.,Goorgipour S.,Moazeni M and Shirian S..
Abattoir prevalence, organ distribution ,public health and economic importance of major metacestodes in sheep, goats
and cattle in Fars, southern Iran Tropical Biomedicine,2012; 29(3):349-359.
5. Darzi MM. Pathology of Taenia hydatigena cysticercosis in a
naturally infected lamb. Journal of Veterinary Parasitology.
2002; 16(l 2):173-174.
6. Wondimu, A.,
Abera, D. and Hailu, Y. A study on the prevalence, distribution and economic
importance of Cysticercus tenuicollis in visceral organs of small
ruminants slaughtered at an abattoir in Ethiopia. Journal of Veterinary
Medicine and Animal Health.2011; 3, 67–74.
7. .Endale
M;Shihum S;Jemere B and Desie S .. Sheep and goats Cysticercus tenuicollis
prevalence and associated risk factors African journal of Agricultural Research.
2013; 8 (24) pp 3121-3125.
8. Nimbalkar RK., ShindeSS.,KamtikarVN and MuleySP..Study on Taenia hydatigena in the slaughtered sheep (Ovis bharal) and
goats(Capra hircas) in Marharashtra ,India. Global Veterinaria. 2011;6(4);374-377.
9..Radfar MH,
Tajalli S and Jalalzadeh M. Prevalence and morphological characterization of Cysticercus
tenuicollis (Taenia hydatigena cysticerci) from sheep and goats in
Iran. Veterinary Arhiv. 2005;75: 469- 476.
10 .Mosaab A, E, O, Layla O, E, Mohammad ,S, Al-A, Ahmed,
M, E, Ahmed, O, E, Abdelnasser A,. H, T. Molecular characterization of Cysticercus
tenuicollis of slaughtered livestock in Upper Egypt governorates. Asian . Pac. J. Trop. Biomed 2016;
6 (8):706-708.
11..Alaa Azmy Yousef Jayousi. Prevalence and Molecular
characterization ofCysticercus tenuicollis cysts in sheep slaughtered in Palestine,2014 .Thesis .Faculty of Graduate students An .Najah-National University.
12. Utuk AE and Piskin
FC . Molecular Detection and Characterization of Goat Isolate of Taenia
hydatigena in Turkey. The Scientific World Journal doi:10.1100/. 2012;962732.
13. AL-Ukaelii ,S.A. and AL -Shaeb,S.M.1998 . Statically analysis used
SPSS program AL-Shoroq House for Publication and Advertisement
Amaan, Jordan.
14. Senlik,B. Influence of
Host breed, sex and age on the prevalence and intensity of C. tenuicollis in sheep. J. Anim.
Vet. Adv. 2008 ; 7(5);548-551.
15. Samul, G ,Zewde GG. Prevalence risk factors and distribution of C. tenuicollis in visceral organ of slaughtered sheep and goats
in central Ethiopia. Trop.Anim. Health. Prod. 2010;42 (96)1049-1051.
16.Deplazes,P.;Gottstein,B.;Stingelin,Yand
Eckert,J. Detection of copro-Antigen by
ELISA in dogs.1990 .Vet. Parasitol. J .,36(1); 91-103
17.Ghaffar NM. Tenuicollosis in slaughtered sheep at Duhok abattoir.Kurdistan region
of Iraq .Bas. J. Vet. Res. 2011; 10 (1);1-16.
18. McManus,D.P..“Molecular discrimination of taeniid
cestodes,”Parasitology International, 2006. vol. 55, pp. S31–S37,
19. Campbell, G., Garcia, H.H., Nakao, M., Ito,
A. & Craig, P.S. 2006 ;Genetic variation 19.
20.Rostami S,
Salavati R, Beech RN, Babaei Z, Sharbatkhori M, Baneshi MR, . Molecular and
morphological characterization of the tapeworm Taenia hydatigena
(Pallas, 1766) in sheep from Iran. J Helminthol. 2015 .
21. Abidi SMA, Nizami WA, Khan P, Ahmad M and Irshadullah M. Biochemical characterization of Taenia hydatigena cysticerci
from goats and pigs. J. Helminthol. 1989; 63: 333-337.
22. Nazifi
S, Ahmadnia S, Bahrami S, Moraveji M, Razavi SM, Moazeni M. Biochemical
Characterization of Cysticercus Tenuicullis in Iranian Fat-tailed Sheep.
Australian Journal of Basic and Applied
Sciences. 2011;5 (3):248-251.
23.AL-Bakri H. Prevalence of Tenuicollosis
among livestock slaughtered
at Ninevah Governorate –Iraq.J.Adva,Biom,and Pathobio.Rese. 2012.2;30-39.
24.Athmar KA Alazawi, Detection some chemical and biochemical constituents of Cysticercus tenuicollis cyst fluid of Iraqi goat .J.Entom.Zoo.,2017;.5(2); 814-818.
Index Table 1 below: Multiple sequence alignment analysis of cox1 gene
in local Cysticercus tenuicollis(NO1-NO11) and NCBI-Genbank Cysticercus tenuicollis isolates based on ClustalW alignment analysis
using Geneious( 9) software multiple alignment
analysis tools.
AB792722 Taenia hydatigena
mitochondrial cox1 gene for cytochrome c oxidase subunit 1, partial cds,
isolate: Th02
--ATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGATTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTA-
>JQ710588 Taenia hydatigena
voucher MFTH 0005 cytochrome c oxidase subunit 1 (cox1) gene, partial cds;
mitochondrial
--ATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGATTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTT----------
>JQ710616 Taenia hydatigena
voucher MFTH 0095 cytochrome c oxidase subunit 1 (cox1) gene, partial cds;
mitochondrial
--ATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGGTTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGCCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTT----------
>JQ710617 Taenia hydatigena
voucher MFTH 0042 cytochrome c oxidase subunit 1 (cox1) gene, partial cds;
mitochondrial
--ATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGGTTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTT----------
>KT372529 Taenia hydatigena
haplotype SR14 cytochrome c oxidase subunit 1 (cox1) gene, partial cds;
mitochondrial
-----ATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGATTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCT--------
>Sample1
GGATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGGTTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample2
GGATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGATTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample4
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------
--------------------------------------------TGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAACTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample5
---------------------------------------------CTTTTGGTTTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample6
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------
-------------------------------------------GTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample7
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------
-----------------------------------TCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample8
GGATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGATTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAACAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample9
GGATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGATTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCTGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample10
GGATTATTAGTCATATATGTTTGAGAATAAGCATGAGTCCTGATGCTTTTGGATTCTATGGATTATTATTTGCTATGTTT
TCAATAGTCTGTTTGGGTAGAAGTGTGTGGGGTCATCATATGTTTACTGTTGGATTAGATGTTAAGACTGCTGTTTTTTT
TAGTTCAGTCACTATGATTATAGGTGTGCCTACTGGTATAAAGGTGTTTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
>Sample11
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------
-----------------------------------------------TTACTTGGTTATATATGCTTTTAAACTCTCATG
TGAATAAGAGTGATCCTGTTGTTTGATGAATTGTTTCTTTTATAGTTTTGTTTACTTTTGGTGGGGTTACTGGTATTGTG
TTGTCAGCATGTGTATTAGATAAAGTTCTTCATGATACCTGGTTTGTAGTTGCTCATTTTCATTATGTTCTTTCTTTAA
.