©1996-2008 All Rights Reserved. Online Journal of Veterinary Research. You may not store these pages in any form except for your own personal use. All other usage or distribution is illegal under international copyright treaties. Permission to use any of these pages in any other way besides the before mentioned must be gained in writing from the publisher. This article is exclusively copyrighted in its entirety to OJVR publications. This article may be copied once but may not be, reproduced or re-transmitted without the express permission of the editors. Linking: To link to this page or any pages linking to this page you must link directly to this page only here rather than put up your own page.
Online
Journal of Veterinary Research
REFEREE FORM
Please
return to: Editors; Online Journal of Veterinary Research,
onlinejournals@gmail.com
Title: A comparison of IL-1β and IL-8 mRNA and their respective
proteins in equine bronchoalveolar lavage fluid during recurrent airway
obstruction
Authors: Sarli Giuseppe, Peli Angelo , Marrocco Romina , Zanotti Lucia ,
Ducci Alice1 , Isani Gloria , Alessandra Scagliarini , Sassi Francesco , Benazzi
Cinzia , Cinotti Stefano , Pietra Marco S
ID: 29643-2011
The Editor must ensure that the OJVR publishes only papers which are
scientifically sound. To achieve this objective, the referees are requested to
assist the Editor by making an assessment of a paper submitted for publication
by:
(a)
Writing a report on the reverse side of this form,
(b} Check the boxes shown below under 1. and 2. ( YES or NO) [N.B.A "NO" assessment must be
supported by specific comment in the
report.
(c) Make a recommendation under 3.
The
Editor-in-Chief would appreciate hearing from any referee who feels that he/she
will be unable to review a manuscript within two weeks.
1.
CRITERIA FOR JUDGEMENT (Mark "Yes" or "No").
Is the work scientifically sound? Y
Is the work an original contribution? YAre the conclusions justified on the evidence presented? Y
Is the work free of major errors in fact, logic or technique? Y
Is the paper clearly and concisely written?Y
Do you consider that the data provided on the care and use of animals (See Instructions to Contributors) is sufficient to establish that the animals used in the experiments were well looked after, that care was taken to avoid distress, and that there was no unethical use of animals? Animal ethics statement has been included in text
2 PRESENTATION (Mark "Yes" or
"No").
Does the title clearly indicate the content of the paper? Y (see suggestions)
Does the abstract convey the essence of the article? Y (see changes)
Are all the tables essential? Y
Are the figures and drawings of good quality? Y
Are the illustrations necessary for an understanding of the text? Y
Is the labelling adequate? Y
3. RECOMMENDATIONS(Mark one with an X)
Not suitable for publication in the OJVR
Reassess after major changes
Accept for publication with minor changes X
Accept for publication without changes
4.REPORT: This work is a study of non-cytokine proteins
that could be involved in inflammation as well as their related mRna in stabled
horses as distinct to cytokines (mRna). The findings could be relevant due to
the importance of the conditions in stabled horses worldwide. The number of
animals compared is not ideal and as noted in instructions for authors would
have been better to have two populations of 8 each. However the statistical
methods used were appropiate. The reviewer notes the difficulty in obtaining
equines for this type of work and a minimum of 4 in this case is acceptable for
control pasture group 2. In my view, at most, the results are only suggestive of
a role for non-macrophage cells involvement inducing RAO. ABSTRACT. Some
conclusions are required here see suggested changes below. INTRODUCTION. NA,
MATERIALS and METHODS NA, RESULTS NA, DISCUSSION NA, REF NA accpt with minor
modifications WR.
The role of different cytokines in triggering airway inflammation during recurrent airway obstruction (RAO) has become the focus of recent investigations. The majority of published papers are principally concerned with cytokine mRNA while there are fewer papers which deal with their respective proteins alone or their correlation with mRNA in the same trial. In the present study IL-1β and IL-8 mRNAs and their respective proteins were quantified by Real Time RT-PCR and western blot and related to bronchoalveolar lavage fluid (BALF) cytology in 8 horses during an RAO attack induced by stabling on straw. The results were compared to those obtained from 4 susceptible horses kept in a pasture. Significant changes in cytokine profile and BALF pattern were observed in the challenge group during the study (12 days) while no modifications were detected in the control group. An increase in IL-1β mRNA and protein preceded the increase of the same parameters as IL-8, but the related mRNA and respective protein levels did not strictly follow the same pattern. The rise in IL-1β protein, but not mRNA, continued over the entire period and was correlated with BALF neutrophilia. On the contrary, the increase in both IL-8 mRNA and protein were transient, and the peak of the protein (day 8) followed the peak of BALF neutrophilia.
Suggestion: Somehow try to include SOME of this information in ABSTRACT
The increase of IL-1β, paralleled by neutrophil and epithelial cell accumulation
in the BALF, is indicative of the active production of the cytokine by these
cells. The accumulation of neutrophils is recorded earlier than the increase of
IL-8 indicating the presence of different chemokines for neutrophils in the
early phase of the disease. Even if the amounts of pro-inflammatory cytokines
produced by cells other than macrophages, namely neutrophils and epithelial
cells, is low, their elevated number could result in a cumulative amount higher
than that of macrophages. This reinforces the pivotal role of cells other than
the macrophages in driving airway inflammation during RAO.
BACKGROUND
Recurrent Airway Obstruction (RAO) is a major equine affliction associated with
stabling, and it is a common cause of exercise intolerance and poor performance
in horses which frequently leads to eliminating animals from competitions [Sasse,
2001; Beech, 2002]. Although most Authors consider this disorder as a valid
model of spontaneous disease for studying the asthma in humans, the exact
aetiopathogenesis is still under debate and many factors have been suggested to
have a role in its etiology [Ainsworth et al., 2006, 2007; Deaton et al., 2007;
Jost et al., 2007].
The role of different cytokines in triggering airway inflammation during RAO has
become the focus of recent investigation. The majority of published papers are
principally concerned with cytokine mRNA [Franchini et al., 1998; Lavoie et al.,
2001; Ainsworth et al., 2003; Cordeau et al., 2004; Horohov et al., 2005;
Kleiber et al., 2005; Laan et al, 2006; Riihimäki et al., 2008] while there are
fewer papers which deal with their respective proteins alone [Franchini et al.,
2000, Desjardins et al., 2004] or their correlation with mRNA in the same trial
[Ainsworth et al., 2006; Gigučre et al., 2002; Perkins et al., 2008].
The cytokines investigated are mainly IL-4, IL-2, IL-17 and IFN-γ [Ainsworth et
al., 2006, 2007; Lavoie et al., 2001; Ainsworth et al., 2003; Cordeau et al.,
2004; Horohov et al., 2005,; Kleiber et al., 2005] with the aim of demonstrating
a Th1- or a Th2-dependent pathogenetic mechanism; however, a final conclusion
has not been reached and various responses have been proposed [Horohov et al.,
2005].
In several studies pro-inflammatory cytokines (IL-1β and IL-8) have been
investigated by different ways: only as the mRNA [IL-1β, Laan et al., 2006;
Gigučre et al., 2002; Pietra et al., 2007; IL-8, Franchini et al., 1998;
Ainsworth et al., 2003; Laan et al, 2006; Pietra et al., 2007; Riihimäki et al.,
2008] or protein [IL-8, Desjardins et al., 2004; Gigučre et al., 2002] and in a
minor extent comparing mRNA and protein [IL-8, Ainsworth et al., 2006; Gigučre
et al., 2002; Perkins et al., 2008]. Considering the post-transcriptional
mechanisms operating in gene expression, it is necessary to design studies where
both mRNAs and their respective proteins are investigated. This is due to the
fact that evidence of gene expression does not prove active synthesis of the
relevant protein. Considering that the majority of the studies on RAO and
cytokines concern the transcript, they do not provide certain information on the
role of the active cytokine. Furthermore, it is difficult to compare the data
available in the literature because the times of sampling after RAO induction
are very different ranging from 1 day to 7 weeks post challenge [Ainsworth et
al., 2003, 2006; Kleiber et al., 2005; Laan et al, 2006; Desjardins et al.,
2004; Gigučre et al., 2002].
Cytokines have a short half-life (hours) [Verfallie et al., 2001] and long and
very different post-challenge times of sampling can give scant information on
their possible role. In view of the limited information concerning mRNA-protein
relationships of pro-inflammatory cytokines in RAO, the aim of the present paper
was to evaluate mRNA and protein for IL-1β and IL-8 in the BALF of RAO-induced
horses, and the comparison of the results with the BALF cell modification. The
data came from an initial challenge of horses stabled on moldy hay which had an
anamnesis of RAO; during the time of this challenge several BALF samplings were
planned to investigate IL-1β mRNA and IL-8 mRNA and their respective proteins. A
second set of data were obtained by immunohistochemical investigation on BALF
cytospin slides of an RAO-affected horse to ascertain the cell-type containing
IL-1β and IL-8 protein.
MATERIALS AND METHODS
Statement of animal care
All experimental procedures were approved by the Ethic and Scientific Committee
of the Alma Mater Studiorum of the University of Bologna (protocol n. 04/55/09)
and subsequently submitted to the Ministry of Health. The study was carried out
in accordance with European legislation regarding the protection of animals used
for experimental and other scientific purposes (Council Directive 86/609/EEC).
Animals
Twelve saddle horses were used in the study. The horses employed were RAO-susceptible
horses previously (a year before) employed for similar trials, which developed
cough, dyspnoea, pulmonary neutrophilia (> 15% BALF neutrophils) and increased
pleural pressure excursions (ΔPplmax > 15 cm H2O – Venti-Graph PG 100/REC -
Boehringer Ingelheim) when stabled and exposed to hay indicative of RAO
(Ainsworth et al., 2003), without alteration of other parameters of blood count
and serum biochemistry parameters over the reference values. During the 6 months
prior to the study, the animals were kept in a pasture, vaccinated and dewormed,
and showed no clinical signs of RAO. The day before the test, all horses were
subjected to pulmonary pressure measurement using the Venti-Graph PG 100/REC (Boeringer
Inghelheim), with maximum values of ΔPplmax less than 4 cm H2O.
Experimental protocol
The horses were randomly divided in two groups: one was left in the pasture and
used as the control group (Group B, no. = 4, two males and two females aged 16
to 24 years, mean±SD 22.5±4.4) and the other was the challenged group (Group A,
no. = 8, four males and four females aged 17 to 26 years, mean±SD 22.5±3.). With
the aim of eliciting the clinical form of RAO, the animals in Group A were moved
from the pasture to a poorly ventilated stable with the doors and air vents
closed, on unchanged straw, eating hay and, once a day, moldy hay was shaken in
front of the horses’ heads in order to increase the environmental powder (re-acutization
method based on the previous study of Gigučre et al, 2002, Ainsworth et al 2002
and Ainsworth and Cheetam, 2010).
A clinical examination was performed once a day in each group and a
bronchoalveolar lavage was executed in the morning (starting at nine o’clock
alternatively among the two groups), before the challenge (T0) to get baseline
values, and after 3 (T3), 5 (T5), 8 (T8), 10 (T10) and 12 (T12) days from the
onset of the trial. After the bronchoalveolar lavage at T8 the horses of the
challenge group were treated with dexamethasone (0.05 mg/kg/iv) once a day for 2
days, and the indoor environment was modified by changing the straw and opening
the windows in order to reduce the environmental powder. Each bronchoalveolar
lavage was performed after tranquilization with an IV injection of Acepromazine
(Prequillan® - 0.2 ml/100 kg) and Detomidine (Domosedan® - 0.1 ml/100 kg) using
a BAL catheter (Kruuse, Worldwide Veterinary Supplier - Denmark) passed nasally
into the distal respiratory tract. A 210 ml aliquot of sterile pre-warmed
(37-38°C) isotonic saline solution, followed by 30 ml of air, was infused and
re-aspirated through a 60-mL syringe and then passed into a glass which was kept
on ice (Mazan et al., 2003). Each sample was processed within 15 min of
collection. The fluid was filtered by means of sterile gauze, centrifuged at 4°C
at 2000 x g for 10 minutes and the cell pellets washed twice in
phosphate-buffered saline. The sample was then separated into 3 aliquots for
cytology, Western blot and RT-PCR, the latter two frozen in nitrogenous up to
the time of protein or RNA extraction.
BALF cytology
The microscopic evaluation of the BALF cellularity to achieve the differential
cells count was determined on a cytospin slide (Cytospin 3, Shandon). Briefly
150 μl of the washed sample were placed in cytochambers and centrifuged at 100 x
g for 10 min. The slides were air-dried before staining with May-Grünwald Giemsa
quick stain (Diff Quick®, Bioptica, Italy) and a cover slip was placed over the
cells using DPX mounting medium. For the differential cell count (DCC), 400
cells were classified under high magnification as macrophages, lymphocytes,
neutrophils, eosinophils or epithelial cells, and were expressed as a percentage
of the total count.
Western Blot analysis
Frozen BALF samples were lysed in deionised water. Total protein concentration
was measured according to the Lowry method using a DC Protein Assay kit
(Bio-Rad, Hercules, CA, U.S.A.). Bovine serum albumin (BSA) was used as a
standard. Each sample was tested at 750 nm in triplicate using 96-well
microtiter plates in a MultisKan EX spectrophotometer.
SDS-PAGE was performed in an Invitrogen Xcell SureLock Mini-Cell using 4-12%
Bis-Tris minigels with MES running buffer at pH 7.3, under reducing conditions.
Appropriate volumes of the samples were loaded into each well in order to obtain
25 g protein/lane. Each gel was also loaded with standard proteins of known
molecular weight (SeeBlue® Plus2, Invitrogen Ltd, Paisley, UK). The
electrophoresis system was connected to a power supply (Power Pack Basic –
Bio-Rad, Hercules, CA U.S.A.) with a constant voltage of 200 V for 50 min. After
electrophoresis, the proteins were transferred to PVDF membranes for 1 h in an
Invitrogen Xcell SureLock Blot Module using transfer buffer having a pH of 7.2.
The blots were blocked with concentrated casein solution in buffered saline
solution and then incubated with diluted primary specific antibody for 90 min:
monoclonal anti-recombinant human IL-1β (2 μg/ml), monoclonal anti-recombinant
human IL-8 (2 μg/ml) and monoclonal anti-synthetic β-actin (0,1 μg/ml) (all from
Sigma-Aldrich Co). All the primary antibodies were of the IgG1 isotype. The
membranes were washed with a specific antibody wash solution (concentrated
buffered saline solution containing detergent, from Invitrogen) and incubated
with the secondary antibody solution consisting of alkaline phosphatase-conjugated
anti-mouse IgG for 45 min. The blots were then visualized using a chromogenic
substrate containing BCIP (5-bromo-4-chloro-3-indolyl-1-phosphate) and NBT
(nitro blue tetrazolium). Negative controls were obtained by substituting the
primary antibodies with an unrelated monoclonal antibody (DAKO Cymation, X0931)
of the same isotype (IgG1).
The relative protein content was determined by the ratio between the optic
densidy (OD) of the interleukin band and the OD of the reference gene protein
using Scion Image software (Scion Corporation, Frederick, Maryland, U.S.A.).
Briefly in each interleukin band an area uniform as for the gray level of the
pixel was selected and the OD was calculated; the same area was applied to the
β-actin band present in the same lane, even in this case aiming to select the
field in which the area was uniform and then the OD was obtained. The protein
(interleukin) level is expressed in arbitrary units (AU) i.e. the ratio between
interleukin OD and the lane matched β-actin OD.
Immunohistochemistry for IL-1β and IL-8
From a horse hospitalized in the Internal Medicine Section of the Department of
Veterinary Medical Science with an anamnesis and a confirmed diagnosis of RAO
(occurrence of cough and bronchospasm once housed indoors, neutrophils > 15% of
the BALF cellularity and pleural pressure excursion > 15 cm H2O) cytospin slides
prepared as above were fixed in cold aceton and stored at -80°C until used. For
immunohistochemical staining, the slides were hydrated and endogenous peroxidase
was blocked by immersion in 0.3% hydrogen peroxide for 20 min. The sections were
then rinsed in Tris Buffer and preincubated with a serum-free protein block (Dako,
Amsterdam, The Netherlands) for 10 min at room temperature. The primary
antibodies (same source as above), anti-human IL-1β diluted 1:20 (in PBS and
0.1% Triton X-100 from Sigma-Aldrich) and anti-recombinant human IL-8 diluted
1:20 (in PBS and 0.1% Triton X-100), were applied for 2 hours at room
temperature and were followed by a commercial streptoavidin–biotin-peroxidase
procedure (LSAB Kit, Dako, Amsterdam, The Netherlands). Diaminobenzidine (0.05%
for 10 min at room temperature) was used as a chromogen. The slides were then
stained with May-Grünwald Giemsa quick stain (Diff Quick®, Bioptica, Italy).
Negative controls were obtained by substituting the primary antibody with an
unrelated monoclonal antibody IgG1 isotype (DAKO Cytomation, X0931) of the same
isotype.
RNA extraction and cDNA synthesis
Total cellular RNA was extracted by Trireagent (Sigma, Deisenhofen, Germany)
according to the manufacturer’s protocol. All RNA samples were treated with
DNAse I (Gibco BRL) in order to remove any trace of genomic DNA contamination.
Briefly, 1 U of DNAse I was mixed with 9 μl of total extracted RNA, incubated
for 30 min at 37şC and then inactivated for 5 minutes at 95şC. cDNA strands were
generated mixing 5 μl of RNA into a reaction buffer with MgCl2 5mM, 10x RNA PCR
Buffer 1X, dNTP mixture 1 mM, 0.25 units/μl of Reverse Transcriptase AMV
(Takara, Japan), 1 unit/μl of RNase Inhibitor, Random 9 mers 2.5 μM in a final
volume of 20 μl of reaction. The retro transcription time was 10’ at 30°C, 15’
at 45°C and 2’ at 99°C.
Quantitative real-time PCR analysis
The Rotor Gene 3000 (Corbett Research, Australia) was used for the amplification
and data collection. Primers (Table 1) for gene cytokines (β-actin, IL-1 β,
IL-8) were designed by using Oligo software (Molecular Biology Insights,
Cascade, CO, U.S.A.). The beta actin gene was used as an internal reference gene
to normalize the variation of cell numbers in the bronchoalveolar lavage fluid.
The β-actin primers were designed based on the partial equine mRNA sequence.
Messenger RNA quantification for each target gene was achieved by constructing
standard curves using cDNA of known concentrations of plasmid in which we
inserted the target gene through a cloning reaction. The standard curves
consisted of serial dilutions of the PCR amplicon corresponding to the gene of
interest. Ten-fold dilutions of recombinant plasmid from 106 copies down to 101
copies were used as standards. All concentrations of target gene cDNA were
calculated relative to their respective standard curves.
Table 1. Primer sequences used in RT-PCR assays.
Forward primers (5’-3’) Reverse primer (5’-3’) Frame (bp)
IL-1β GAGGCAGCCATGGCAGCAGTA TGTGAGCAGGGAACGGGTATCTT 257
IL-8 TCTCTTGGCCGTCTTCCTG CCGTTGACGAGCTTTACAA 195
Β-actin CTGGCACCACACCTTCTACAACGAG TCACCGGAGTCCATCACGA 214
A real time PCR assay using the Syber Green method was carried out at a final
volume of 25 l containing 1X of SYBR PREMIX Ex Taq Takara, 200 nM each forward
and reverse primers, 1X of Rox Reference Dye and 2 μl of cDNA. The following
were the cycling parameters: 10 min at 95°C for polymerase activation followed
by 40 cycles of 15 sec at 95°C, 15 sec annealing (IL-1β 55°C; IL-8 55°C; actin
56°C), 20 sec at 72°C. The signal was acquired on the FAM channel (multichannel
machine) (source, 470 nm; detector, 510 nm; gain set to 5) with the fluorescence
reading taken at the end of each 72°C step.
To distinguish specific from non-specific products and primer dimers, a melting
curve was obtained after amplification by holding the temperature at 72 °C for
12 s followed by a gradual increase in temperature to 95 °C at a rate of
0.1°C/s, with the fluorescence signal acquisition mode set to step. All the data
are expressed as the ratio (R) between the copies of the target (t) gene and the
copies of reference (r) gene actin (Rt-r) [Bowles et al., 2002].
Statistical analysis
Due to the low number of horses in each group and the data not even close to
equal interval scales two nonparametric test have been employed for statistics.
The comparison between each point measure (from T3 to T12) and the baseline
values (before challenge, at T0) in the challenged group was conducted with the
Wilcoxon Matched Pairs Test; the comparison of each point measure between
control and challenged groups was done with the Kruskall-Wallis ANOVA median
test. Variables compared as above reported were interleukin mRNA Rt-r and AU.
Variations in BALF cell percentages were compared, cumulatively across all the
trial period (from T0 to T12), between controls and challenged animals by the
Kruskall-Wallis ANOVA median test. Linear associations (correlation coefficients
- R) between variables were explored and assessed using Pearson’s test. Values
of P < 0.05 were considered significant.
RESULTS
Clinical signs
The horses in Group A showed evident respiratory distress starting the first day
after challenge, with clinical signs of nasal flaring, monolateral or bilateral
serous or mucous nasal discharge, coughing, abdominal lift, increased vesicular
murmur and, in one case, ocular discharge. The manifestations of the disease
decreased quickly after environmental modification and therapy with
dexamethasone which followed the bronchoalveolar lavage at T8 and, from T10 to
T12, there was a return to the clinical condition similar to that recorded at
the pre-trial stage . In Group B, none of the control animals showed any
clinical sign of RAO or any clinical manifestation referring to other
respiratory disorders during the entire observation period.
BALF cytology
In Table 2, the data of the DCC at the different days of sampling of Group A
(percentages expressed as the mean±standard deviation calculated among the 8
horses per sampling time) and of Group B (values expressed as the mean±standard
deviation of the 4 animals throughout the entire experimental period) are
reported. In Group A, at T3, the percentage of neutrophils had increased 15%, in
agreement with the previous diagnosis of RAO, and increased constantly
thereafter. Other changes included the reduction of lymphocytes and macrophages
and the increase of epithelial cells and, later, of eosinophils. In Group B, the
DCC maintained values similar to those of the T0 of Group A throughout the
entire experiment. Kruskal-Wallis ANOVA median test revealed a significant
difference in neutrophils, lymphocytes and epithelial cells when comparing DCC
challenged and controls throughout the entire experimental period: the
percentage of neutrophils and epithelial cells was higher in Group A (P<0.05)
while the percentage of lymphocytes was lower in Group A (P<0.05); other
comparisons did not provide any significant results.
Table 2. DCC of the BALF in Group A (values expressed as the mean of the
percentages calculated in 8 animals per sampling time) and Group B (values
expressed as the mean percentage of 4 animals throughout the entire experimental
period).
Time of sampling Neutrophils* Lymphocytes* Macrophages Epithelial cells*
Eosinophils
Group A-T0 12.25±16.65 52.50±17.66 29.88±14.46 4.75±4.62 0.63±0.92
Group A-T3 25.50±6.82 29.00±8.32 34.63±10.07 10.50±4.11 0.38±0.52
Group A-T5 27.00±11.88 34.75±16.14 23.50±8.60 14.50±8.59 0.25±0.46
Group A-T8 28.00±14.67 31.00±7.89 25.25±11.16 15.25±8.35 0.50±1.41
Desensitization: dexamethasone/modification of the indoor environment
Group A-T10 30.13±7.97 42.00±16.88 14.38±5.24 11.88±9.13 1.63±2.20
Group A-T12 28.50±21.25 42.13±16.99 16.63±8.02 11.75±9.97 1.00±1.07
Group B - T0/T12 11.75±1.57 53.02±5.81 30.25±3.51 4.22±4.18 0.76±0.89
*P <0.05, Kruskal-Wallis ANOVA median test between challenged and control horses
across all the trial (from T0 to T12).
IL-1β and IL-8 mRNA
The lengths of specific fragments of cDNA were 257 bp for IL-1β, 195 bp for IL 8
and 214 bp for β-actin, as expected. In Figures 1 A and B, graphics on the
variations of the Rt-r of the mRNA in the challenged animals (Group A) across
the trial are shown for IL-1β and IL-8, respectively. As for IL-1β, after values
similar to baseline at T3, an increase at T5 is recorded followed by a peak at
T8 and a return to baseline values after T10. By the Wilcoxon matched pairs test
the IL-1β Rt-r mean value only at T8 resulted significantly higher (P<0.05) than
the respective baseline (T0) values. As for IL-8, a surprising peak is present
at T0, followed by very low values from T3 to T8; a second peak is present at
T10 followed by a low level at T12. By the Wilcoxon Matched Pairs Test none IL8
Rt-r mean value from T3 to T12 resulted significantly higher than the baseline
(T0) value. In the control group, the level of cytokine expression showed no
significant variation during the study and their Rt-h ranged from 0.0028-0.096
and 0.0095-1.63 for IL-8 and IL-1β, respectively. Significant lower values
(P<0.05) of Rt-r in controls compared to challenged horses were revealed at
sampling times T0, T3, T5, and T12 for IL-1 β and at sampling times T5, T8, T10
and T12 for IL-8 using Kruskal-Wallis ANOVA median test.
Figure 1. The relationship between IL-1β (A) and IL-8 (B) mRNAs and their
respective proteins expressed as RT-PCR Rt-r and western blot AU. Red arrows
indicate desensitization.
IL-1β and IL-8 protein assessment
Western blot. Anti-IL-1β antibody revealed a band of approximately 17 kDa,
similar to the expected size of equine IL-1β [Howard et al., 1998] (Figure 2a)
while anti-IL-8 antibody demonstrated a band of approximately 8 kDa, similar to
the expected molecular weight of several specie-specific IL-8 proteins [Lisaza,
2001] (Figure 2b). Reference gene (beta-actin) was revealed by the specific
antibody as a band of 42 kDa.
In Figures 1 A and B for IL-1β and IL-8, respectively, graphics on the
variations of the levels of the cytokines across the trial (expressed as AU) in
the challenged horses are given. As for IL-1β, an increase was registered from
the first post-challenge sampling (T3) and was present until the end of the
experiment (T12). By the Wilcoxon matched pairs test the IL-1β AU mean values
from T3 to T12 resulted significantly higher (P<0.05) than the respective
baseline (T0) values. As for IL-8, after values similar to baseline at T3 and T5
a peak was registered at T8, followed by a second peak at T12. By the Wilcoxon
Matched Pairs Test only the IL-8 AU T8 mean value resulted significantly higher
(P<0.05) than the baseline (T0) value.
In the control group, the cytokine level showed no significant variations during
the study, and their AU ranged from 0.00-0.003 to 0.017-0.025 for IL-8 and
IL-1β, respectively. Using Kruskal-Wallis ANOVA median test a significant
difference (P<0.05) in AU was revealed from T3 to T10 for IL-1β and from T0 to
T12 for IL-8 when comparing per sampling times challenged horses and controls,
the latter showing values lower than the former.
Figure 2. Western blot analysis of the BALF in 5 horses of the challenged group.
A) IL-1β at T3 (lanes 1-5) and T5 (lanes 6-10). B) IL-8 at T5 (lanes 1-5), and
T8 (lanes 6-10). Monoclonal antibodies against IL-1β, IL-8 and reference gene
(Beta actin) were used. The expected products of approximately 17 kDa (Il-1β), 8
kDa (IL-8) and 42 kDa (beta actin) are indicated close to line 11 (marker).
Immunohistochemistry. IL-1β immunohistochemical stain was observed as a brown
cytoplasmic colour of macrophages, epithelial cells and granulocytes (Figures 3
a, b, c), and IL-8 positive stain was detected in the cytoplasm of the
epithelial cells and macrophages (Figures 3 e, f).
Figure 3. BALF cytospin. Immunohistochemical staining for IL-1β (a, b, c) and
IL-8 (e, f, g). Brown cytoplasmic staining for IL-1β in neutrophils (a), in a
macrophage and a neutrophil (b) and in an epithelial cell (c). Negative staining
for IL-8 in granulocytes (d), positive staining in macrophages (e) and in 2 out
of the 5 epithelial cells in the field (f).
mRNA-protein-BALF cellularity comparisons (Table 3)
In Group A, using the Pearson correlation test, no association between mRNA and
protein was found for both IL-1β and IL-8 as well as between the RT-PCR Rt-r of
both cytokine mRNA and BALF cell modifications. IL-1β AU were significantly
associated with neutrophils and epithelial cells variations (Figures 4 a, b),
but not with other BALF cell modifications. Even if no association was
appreciable between IL-8 levels of the protein and BALF cell modifications, the
peak of IL-8 AU was contextual (T8) with the peak of the epithelial cells in the
BALF; then its decrease paralleled the IL-8 protein reduction (Figure 4 c). In
Group B, no association was found between the Rt-r and the AU of both cytokines
or between the latter and BALF cellularity.
Table 3. Pearson correlation between BALF cell type variations and RT-PRC or WB
results in group A horses.
WB IL-1β AU WB IL-8 AU RT-PCR IL8 Rt-r RT-PCR IL-1β Rt-r
Neutrophils R=0.9859
P=0.00001 R=0.1718
P=0.745 R=-0.5363
P=.273 R=0.1929
P=.714
Lymphocytes R=-0.7125
P=.112 R=-0.2630
P=0.615 R=0.7855
P=.064 R=-0.3949
P=.438
Macrophages R=-0.4520
P=.368 R=-0.0198
P=0.970 R=-0.1361
P=0.797 R=0.0242
P=.964
Epithelial cells R=0.8399
P=0.036 R=0.3837
P=0.453 R=-0.6941
P=0.126 R=0.6136
P=0.195
Eosinophils R=0.2329
p=.657 R=-0.2109
P=.688 R=0.5584
P=0.249 R=-0.5694
P=.238
Figure 4. The relationship between IL-1β western blot AU and neutrophils (a) or
epithelial cells (b), or between IL-8 western blot AU and eosinophil (c)
variations in the BALF during the experiment. Red arrows indicate
desensitization. For statistics, see text.
DISCUSSION
The triggering of inflammation in RAO is due to 2 main pathways: innate immunity
and the late phase of type I hypersensivity. The former mechanism encompasses
the ability of alveolar macrophages to acquire a secretive phenotype,
particularly capable of secreting several cytokines which initiate and maintain
airway inflammation [Franchini et al., 1998]. The late phase of type I
hypersensivity plays a central role in a Th mixed response, mainly Th2 at the
beginning and Th1 in the late phase of the process [Horohow et al., 2005]. Both
ways contribute to triggering inflammation and neutrophils recruitment in the
airways by means of several cytokines such as IL-1β and IL-8, respectively
[Ainsworth et al., 2006; Laan et al, 2006; Gigučre et al., 2002]. Since the
majority of the papers available on heaves concern cytokine gene expression
rather than their respective protein assessment, the main aims of this study
were to compare mRNA and protein assessments for IL-1β and IL-8 as well as
comparing both variables with BALF cellularity variations in horses in which an
acute onset of the disease was induced. Then, because a surprising association
between IL-1β and neutrophils appeared (Figure 3a), a further sampling from RAO
horses, using immunohistochemistry was carried out to demonstrate the presence
of these cytokines in the neutrophils.
IL-1β was revealed to have a significant association with neutrophils (Figure
3a) and epithelial cells (Figure 3b) in which a definite immunolocalization was
proven. As for the role of equine neutrophils in producing cytokines after being
primed with several factors, their ability to produce TNF-α, IL-1β, IL-6, IL-8
and macrophage inflammatory protein 2 (MIP-2) is well-known [Joubert et al.,
2001]. Neutrophils in heaves, as well as in other lung pathologies characterized
by neutrophil accumulation, acquire the role of modulating inflammation in this
way and not only as an effector mechanism recruited in airways. As for the
association between IL-1β and epithelial cells, this likely reflects the
pro-inflammatory cytokine production during RAO which takes place in the airway
epithelium triggered by the NF-Kb transcription factor [Ainsworth et al., 2006].
The cytokines essential for initiating inflammation are considered to be almost
exclusively produced by macrophages and a theory has been proposed to explain
the exaggerated amounts of pro-inflammatory cytokines produced during RAO
episodes by the s.c. “secretory” phenotype of alveolar macrophages [Franchini et
al., 1998]. In view of the results here presented, a pro-inflammatory role of
the products of both neutrophils and epithelial cells must be taken into
consideration. If macrophages play a role in initiating cytokine production, the
ability to maintain airway inflammation is instead due to other cell types,
namely epithelial cells and neutrophils.
It is well-known that the main producers of IL-8 are the airway epithelial cells
[Ainsworth et al., 2006] and a lack of correlation between the above two
variables is surprising in our data. However, the peak of IL-8 was recorded when
the peak of the epithelial cells was reached in the BALF. Ainsworth et al.
[2006] demonstrated a 3-10 fold increase of IL-8 m-RNA in epithelial airway
cells and, using immunohistochemistry, its localization in the cytoplasm of
epithelial cells in airway biopsies. The amounts of epithelial cells which
desquamate and are present in the BALF are not sufficient to demonstrate the
role of these cells in the production of IL-8 as appears in the above mentioned
study.
The challenge applied to induce RAO was planned according to the criteria
proposed by Mc Gorum (1993) and also applied by other Authors [Verfaillie et
al., 2001; Kleiber et al., 2005] as well as by our research group in a previous
investigation [Pietra et al., 2007], confirming its usefulness for the study of
RAO. Both clinical signs and BALF neutrophilia present only in the RAO-susceptible
horses of Group A confirmed the induction of the disease by means of the
environmental stimulation reproduced in the stalls. The lack of over-expression
of cytokines in the RAO-susceptible horses of the control group (Group B) was
tied to minimal changes in the respective protein during the entire study and
this finding is in agreement with the BALF cytology results. In challenged
animals, the trend of mRNA for both cytokines is similar to those of other
published studies [Kleiber et al., 2005; Franchini et al., 2000; Gigučre et al.,
2002; Pietra et al., 2007] with the peak of IL-1β mRNA followed by IL-8 mRNA. In
this investigation, 2 out of the 8 challenged horses had very high levels of
IL-8 RT-PCR Rt-r at T0 which raised the mean value of the group as reported in
the results. In the literature, high levels of IL-8 m-RNA in RAO-susceptible
horses are also reported regardless of treatment with fluticasone as compared to
non-treated RAO-susceptible animals [Gigučre et al., 2002]. In the study,
similar results are presented concerning the protein (IL-8) which was elevated
in RAO-susceptible horses regardless of the sampling time, especially despite
normal pulmonary function tests and in the absence of clinical signs of
respiratory disease and BAL neutrophilia [Gigučre et al., 2002].
Even if, in our study, the proteins followed the same trend reported for mRNA,
this too is also well-known from other studies [Franchini et al., 2000; Gigučre
et al., 2002]; surprisingly protein peaks did not follow mRNAs with the
unexpected condition to have in some point times evidenced the protein without a
previous presence of the related mRNA. This only apparently paradoxical
condition can be explained by the lag time in the half-life of these molecules
as compared to the sampling. It is well-known that molecular kinetics of
cytokines involves hours while the sampling after challenge was planned with
intervals of days. For this reason, the time between the samplings has produced
some gaps in the demonstration of the mRNA with respect to the protein.
Due to post-transcriptional checkpoints, the presence of mRNA is not conclusive
for the production of the transduced product (protein). For this reason, it is
important that investigations on cytokines implication in RAO also include
protein assessment. In this study, we demonstrated a similarity in the trends of
mRNAs and proteins but, to demonstrate a close relationship between the two sets
of data, a sampling time closer to the half-life of the cytokines (in hours)
would be of benefit.
CONCLUSIONS
The increase of IL-1β, paralleled by neutrophil and epithelial cell accumulation
in the BALF, is indicative of the active production of the cytokine by these
cells. The accumulation of neutrophils is recorded earlier than the increase of
IL-8 indicating the presence of different chemokines for neutrophils in the
early phase of the disease. Even if the amounts of pro-inflammatory cytokines
produced by cells other than macrophages, namely neutrophils and epithelial
cells, is low, their elevated number could result in a cumulative amount higher
than that of macrophages. This reinforces the pivotal role of cells other than
the macrophages in driving airway inflammation during RAO.
ACKNOWLEDGEMENT
The authors are grateful to Gerald Goldsmith for English language editing.
COMPETING INTERESTS
The authors declare that they have no competing interests.
REFERENCES
1. Ainsworth DM, Appleton JA, Antczak DF, Santiago MA, Aviza G.: IgG antibody
responces to an inhaled antigen in horses with “heaves” (recurrent airway
obstruction). Vet Immunol Immunopathol 2002; 84: 169-180.
2. Ainsworth DM, Cheetam J.: Disorders of the respiratory system. In: Reed SM,
Bayly WM, Sellon DC, eds Equine Internal Medicine. 3th ed. St.Louis, MO:
Saunders Elsevier, 2010: 290-371
3. Ainsworth DM, Grünig G, Matychak MB, Young J, Wagner B, Erb HN, Antczak DF:
Recurrent airway obstruction (RAO) in horses is characterized by IFN-γ and IL-8
production in bronchoalveolar lavage cells. Vet Immunol Immunopath 2003, 96:
83-91.
4. Ainsworth DM, Wagner B, Erb HN, Young JC, Retallick D: Effects of in vitro
exposure to hay dust on expression of interleukin-17, -23, -8, and -1 beta and
chemokine (C-X-C motif) ligand 2 by pulmonary mononuclear cells isolated from
horses chronically affected with recurrent airway disease. Am J Vet Res 2007, 68
1361-1369.
5. Ainsworth DM, Wagner B, Franchini M, Grünig G, Erb HN, Tan J-Y:
Time-dependent alterations in gene expression of interleukin-8 in the bronchial
epithelium of horses with recurrent airway obstruction. Am J Vet Res 2006, 67:
669-677.
6. Beech J: Chronic Obstructive Pulmonary Disease (Chronic Recurrent Airway
Obstruction). In Large Animal Internal Medicine. Mosby Ed., 3th ed., 517-522;
2002.
7. Bowles KS, Beadle RE, Mouch S, Pourciau SS, Littlefield-Chabaud MA, Le Blanc
C, Mistric L, Fermaglich D, Horohov DW: A novel model for equine recurrent
airway obstruction. Vet Immunol Immunopath, 2002, 87, 385-389
8. Cordeau M-E, Joubert P, DEwachi O, Hamid Q, Lavoie J-P: IL-4, IL-5 and IFN-γ
mRNA expression in pulmonary lymphocytes in equine heaves. Vet Immunol
Immunopath 2004, 97: 87-96.
9. Deaton CM, Deaton L, Jose Cunilleras E, Vincent TL, Baird AW, Dacre K, Marlin
DJ: Early onset air way obstruction in response to organic dust in the horse. J
Appl Physiol 2007, 102: 1071-1077.
10. Desjardins I, Theoret C, Joubert P, Wagner B, Lavoie J-P: Comparison of TGF-beta
1 concentrations in bronchoalveolar fluid of horses affected with heaves and of
normal horses. Vet Immunol Immunopath 2004, 101: 133-141.
11. Franchini M, Gill U, von Fellenberg R, Bracher VD: Interleukin-8
concentration and neutrophil chemotactic activity in bronchoaveolar lavage fluid
of horses with chronic obstructive pulmonary disease following exposure to hay.
AJVR 2000, 61: 1369-1374.
12. Franchini M, Gilli U, Akens MK, Fellenberg RV, Bracher V: The role of
neutrophil chemotactic cytokines in the pathogenesis of equine chronic
obstructive pulmonary disease (COPD). Vet Immunol Immunopath 1998, 66: 53-65.
13. Gigučre S, Viel L, Lee E, MacKay RJ, Hernandez J, Franchini M: Cytokine
induction in pulmonary airways of horses with heaves and effect of therapy with
inhaled fluticasone proprionate. Vet Immunol Immunopath 2002, 85: 147-158.
14. Horohov DW, Beadle RE, Mouch S, Porciau SS: Temporal regulation of cytokine
mRNA expression in equine recurrent airway obstruction. Vet Immunol Immunopath
2005, 108: 237-245.
15. Howard RD, McIlwraith W, Trotter GW, Nyborg JK: Cloning of equine
interleukin 1α and equine interleukin 1β and determination of their full-length
cDNA sequences. AJVR 1998, 59: 704-711.
16. Jost U, Klukowska Rotzler J, Dolf G, Swinburne JE, Ramseyer A, Bugno M,
Burger D, Blott S, Gerber V: A region on equine chromosome 13 is linked to
recurrent airway obstruction in horses. Equine Vet J 2007, 39: 236-241.
17. Joubert P, Silversides DW, Lavoie J-P: Equine neutrophils express mRNA for
Tumor Necrosis Factor-α, Interleukin (IL)-1β, IL-6, IL-8,
macrophage-inflammatory-protein-2 but not for IL-4, IL-5 and Interferon-γ.
Equine Vet J 2001, 33: 730-733.
18. Kleiber C, McGorum BC, Horohov DW, Pirie RS, Zurbriggen A, Straub R:
Cytokine profiles of peripheral blood and airway CD4 and CD8 T lymphocytes in
horses with recurrent airway obstruction. Vet Immunol Immunopath 2005, 104,
91-97.
19. Laan TTJM, Bull S, Pirie RS, Fink-Gremmels J: The role of alveolar
macrophages in the pathogenesis of recurrent airway obstruction in horses. JVIM
2006, 20: 167-174.
20. Lavoie J-P, Maghni K, Desnoyers M, Taha R, Martin JC, Hamid QA: Neutrophilic
airway inflammation in horses with heaves is characterized by a Th2-type
cytokine profile. Am J Respir Crit Care Med 2001, 164: 1410-1413.
21. Lisaza H and K: IL-8. In Cytokine Reference, Volume 1, Ligands. Edited by
Academic Press. London, UK; 2001: 1061-1067.
22. Mazan MR , Hoffman AM.: Clinical Techniques for Diagnosis of Inflammatory
Airway Disease in the Horse. Clin Tech Equine Pract. 2003; 2: 238-257
23. McGorum BC, Dixon PM, Halliwell REW: (1993) Responses of horses affected
with chronic obstructive pulmonary disease to inhalation challenges with mould
antigens. Equine Vet J, 1993, 25 261-267
24. Perkins GA, Viel L, Wagner B, Hoffman A, Erb HN, Ainsworth D.M.: Histamine
bronchoprovocation does not affect bronchoalveolar lavage fluid cytology, gene
expression and protein concentrations of IL-4, IL-8 and IFN-γ. Vet Immunol
Immunopath, 2008, 126, 230-235.
25. Pietra M, Peli A, Bonato A, Ducci A, Cinotti S: Equine Bronchoalveolar
lavage cytokines in the development of Recurrent Airway Obstruction. Vet Res
Commun 2007, 31 (Suppl 1): 313-316.
26. Riihimäki, Raine A, Art T, Lekeux P, Couëtil L, Pringle J: Partial
divergence of cytokine mRNA expression in bronchial tissues compared to
bronchoalveolar lavage cells in horses with recurrent airway obstruction. Vet
Immunol Immunopath, 2008, 122, 256-264.
27. Sasse HHL: Clinician’s perspective of equine airway disease. In
International Workshop on Equine Chronic Airway Disease: 16-18 June 2001. Equine
Vet J 2001, 33: 5-19.
28. Verfaillie T, Cox E, To LT, Vanrompay D, Bouchaut H, Buys N, Goddeeris BM:
Comparative analysis of porcine cytokine production by mRNA and protein
detection. Vet Immunol Imunopath 2001, 81: 97-112.